Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-19.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGCCGTGGCGGAGCAGGCTTTGAATCGTGAAGTGAAAACCATGACCAGCGACCAGCG
CTACGAGCTGATCGTTGAGTATCAGGCGAAATACAACGATGCTGCAAACTATCCTGCT
GAGATCATGATGAAGTACCTCATCATTCTGTCTGAAAGTGGCACTTTGTTCCGTATCT
ATCGTTAGgatttcatggcaaaaggcccgtcgcaaggacgggcctttcttatttcatcatatccccgacgcagagtcctcgccggttgtgacat
gaggatcagtcgccatcacccgggaaagccggGTG

    Bd1370 --- glnS --- pepP_lrep_1


Gene: Bd1370     GI: 42522889     BI number: Bd1370     GOG: -------     Description: RNA helicase
Gene: glnS     GI: 42522890     BI number: Bd1371     GOG: COG0008     Description: glutaminyl-tRNA synthetase
Gene: pepP_lrep_1     GI: 42522891     BI number: Bd0202     GOG: -------     Description: aminopeptidase



 tt
a  t
g  c
G  a
 At
 Tg
 Tg
 Gc
C  a
T  a
A  a        a
 Ta       c  a
 Cg       g  g
 Tg        cg
A  c       ta
T  c       gc
 Gc        cg
 Cg        cg
C  t       cg
T  c       gc
 Tg        gc
 Gc        at
 Ta        at
 Ta        at
            cttatttcatcatatccccgacgcagagtcctcgccggttgtgacatgaggatcagtcgccatcacccgggaaagccggGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0008 Glutamyl- and glutaminyl-tRNA synthetases ... can be seen here

    ..................................................................................................................