                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTGGCTTCGGTGGCGGTCGCGGCGGTGGCGGCGGCGGTAACCGTGGTGGCGGCTTC
GGCGGCGGCAACCGTGGTGGTCGTTTCTAAtttaagattttaatcttagtgaaaagggcggaaagaaatttccgccct
ttttttatttctgaattctgtcttttctgtcgacgcttcagtcagcttacactttccctgtaattcaccaattccacatccacgctaagttcccgatttc
agtcacctcagcagttttgatttattggctctgtccttgctttaaaaacctgcaggaggacggcATG

    Bd1398 Gene: Bd1398     GI: 42522916     BI number: Bd1398     GOG: COG2340     Description: putative transmembrane protei tt t  a ta at gc at at        aa ta       g  a tg        at t  t       at A  |       at A  |       gc T  |       gc Cg        cg Ta        gc Ta        gc Ta        gc |  a       at G  g       at Cg        at Tg        at Gc        gt             ttatttctgaattctgtcttttctgtcgacgcttcagtcagcttacactttccctgtaattcaccaattccacatccacgctaagttcccgatttcagtcacctcagcagttttgatttattggctctgtccttgctttaaaaacctgcaggaggacggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2340 Uncharacterized protein with SCP/PR1 domains ... can be seen here     ..................................................................................................................