Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:8 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAAAAAACAAACTCTTCGAAGACTCTTGGACAGAAATTAAAACTCACTGAttgtgggtt
tgttcgttgccgggtggcgcggggtttggctggggtcttgagggatcccgcctccgcggtacaccatccaggcgccggcaaagaccgctgcgtcgggctc
cctcaagtccccatccaaattgttccagtcggaaatagctaataactatcaatgtgttcttaactgcgcaggtgcacgacgatgccctttggaaccgatg
tctttgtgatgggattttcggaagttgtttctgaattgaTTG

    Bd1416


Gene: Bd1416     GI: 42522933     BI number: Bd1416     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


 ta
t  a
c  c
t  t
 tg
 gc
 tg
 gc
 ta
a  |
a  |
c  |       cc
t  |      g  c
a  |      t  t
t  |       at
c  |       gt
a  |       cg
a  |      |  g
t  |      |  a
a  |      |  a
a  |      a  c       tg
 tg        gc       g  a
 cg        cg       t  t
 gt       |  a       tg
a  g       at        tg
t  c       cg        cg
a  a       gt        ta
a  |      t  c       gt
a  |       gt       |  t
g  |       gt       t  t
 gc        at        at
 cg        cg        gc
 ta        gt        cg
 gc        cg        cg
                        aagttgtttctgaattgaTTG


    ..................................................................................................................