                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGCCGGGCGAAAAAGCGGACGCCTTATATAAGCGCGCTGATGAAGCGCTGTACGAA
TCCAAGCAGACGGGACGCAACAAATACACTGTGTCCAAGGGTTCCCAGATCAAACGTG
TGGCCTGAggcactgtccaacttttagacagttgtCTATAGAACTATGGTGACTACAAAAGCCTGAACA
ATCGTTCGGGCTTTTTTTATGTTCAGAGATTTCTGAACACCCGCAGTGAATTTCCGGT
TCAGATACATtcaacccactccccgtgttggcttcatgcttgctttagcacttcagcATG

    Bd1432 --- Bd1431 --- Bd1430 Gene: Bd1432     GI: 42522948     BI number: Bd1432     GOG: -------     Description: Serine protease, subtilase family Gene: Bd1431     GI: 42522947     BI number: Bd1431     GOG: -------     Description: putative nuclease Gene: Bd1430     GI: 42522946     BI number: Bd1430     GOG: -------     Description: conserved hypothetical protei            AA           G  C            AT            TA            AT            TG            CG           |  T           |  G   t       |  A c  t      |  C a  t      |  T a  t       tA        AT c  a       gC       A  C cg        tA        CG ta        tA        AT gc       g  A       AT ta       a  A       GC cg       c  G       TG |  t      a  C       CG at        gC        CG cg        aT        GC gt        tG        AT gC        tA        AT AT        tA        AT                         TTTTATGTTCAGAGATTTCTGAACACCCGCAGTGAATTTCCGGTTCAGATACATtcaacccactccccgtgttggcttcatgcttgctttagcacttcagcATG     ..................................................................................................................