                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-20.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAAATCTTTATTGCGGAGTCGGCATCATGGCCAAACAGATCAAAAACAAAGGTCTG
ATCACAGTAGGCTCCGGCGCGTACTGGGCTGTGCTAAAAAGCGGTGGCAAATATCAGA
AGATCTCCGAGATCTCTGGCATGGTCAAAAAATTATCCTTCTGTAAGTAAcaagacggtcggg
cgtcgctctgatttccctcggggggcgcccgttccgcacgatctttttgttttctaaaacatttcctttaaaatcttagcctttcaaatattctgcaccg
atcctatagaccaccacatacGTG

    Bd1439 --- Bd1438 Gene: Bd1439     GI: 42522955     BI number: Bd1439     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd1438     GI: 42522954     BI number: Bd1438     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic tc t  c t  c at gc        cc tg       g  c cg        cg tg        gt cg        gt g  |       gc cg        gc tg       |  g gc       |  c cg       g  a gc        gc gc        cg gc        ta             tctttttgttttctaaaacatttcctttaaaatcttagcctttcaaatattctgcaccgatcctatagaccaccacatacGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.90 kcal/mol Antiterminator: Size=33 nt.     Delta G=-20.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAAAAATCTTTATTGCGGAGTCGGCATCATGGCCAAACAGATCAAAAACAAAGGTCTG ATCACAGTAGGCTCCGGCGCGTACTGGGCTGTGCTAAAAAGCGGTGGCAAATATCAGA AGATCTCCGAGATCTCTGGCATGGTCAAAAAATTATCCTTCTGTAAGTAAcaagacggtcggg cgtcgctctgatttccctcggggggcgcccgttccgcacgatctttttgttttctaaaacatttcctttaaaatcttagcctttcaaatattctgcaccg atcctatagaccaccacatacGTG     Bd1439 --- Bd1438 Gene: Bd1439     GI: 42522955     BI number: Bd1439     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd1438     GI: 42522954     BI number: Bd1438     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic cg t  g g  g gc cg        cc at       g  c gc        cg ag        gt ac        gt c  |       gc At        gc Ac       |  g Tt       |  c Gg       g  a Aa        gc At        cg Tt        ta             tctttttgttttctaaaacatttcctttaaaatcttagcctttcaaatattctgcaccgatcctatagaccaccacatacGTG     ..................................................................................................................