Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccctttgctctcaggttgcatttcagtgccataccgacactgaaaaacgggtttgggtcattccagtggggaatattccaagatccgtgccggaaaaaat
gccaccagtttcggcactttttgtagtgctttagggggcttagcgcaagcttattgtggggatttgagggctcattgctgacgcctcatagtcctgaaaa
caaccttccgtttgcggtcgagaaatggatgggatcctgaggcccggacttgagccccccaaagatcttttttacgatgaggacttcatgaggagatttt
ATG

    Bd1447


Gene: Bd1447     GI: 42522961     BI number: Bd1447     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


  c
t  c
t  a
a  a
t  g
a  a
 at
 gc
 gc
g  g       ca
 gt       c  c
 tg        gc
 gc        ta
a  c      a  g
 cg       a  |
 cg       a  |
 ta       a  |
 ta        at
|  a       at
|  a       gt
|  a       gc
a  a       cg
c  t       cg
 tg        gc
 gc        ta
 gc        gc
            tttttgtagtgctttagggggcttagcgcaagcttattgtggggatttgagggctcattgctgacgcctcatagtcctgaaaacaaccttccgtttgcggtcgagaaatggatgggatcctgaggcccggacttgagccccccaaagatcttttttacgatgaggacttcatgaggagattttATG
    ..................................................................................................................