                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:89 nt.    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:23 nt. Size=75 nt.     Delta G= -6.45 kcal/mol
Anti-antiterminator:   Size=69 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-gaaaat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacacaagaaaatattttagaaaatgattgattctacaacaccctgttatttcacatagttagcgtgtctcataactagaccaattaaaaattaaaaa
acgaattcatgcagttacctgaaatttcagttttgggttgttttaaacgaaactgaatccatcaagaagcatggtggggctcaggagggcataaccgtAT
G

    Bd1483 --- Bd1482 --- aglR_lrep_2 --- Bd1480 --- aglS_lrep_1 --- agmU_lrep_1 --- Bd1477 --- Bd1476 --- Bd1475 --- Bd1474 --- Bd1473 Gene: Bd1483     GI: 42522994     BI number: Bd1483     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: Bd1482     GI: 42522993     BI number: Bd1482     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica Gene: aglR_lrep_2     GI: 42522992     BI number: Bd0420     GOG: -------     Description: Adventurous gliding motility protein R Gene: Bd1480     GI: 42522991     BI number: Bd1480     GOG: -------     Description: TolR-like protein, putative Gene: aglS_lrep_1     GI: 42522990     BI number: Bd0838     GOG: -------     Description: Adventurous gliding motility protein S Gene: agmU_lrep_1     GI: 42522989     BI number: Bd0832     GOG: -------     Description: adventurous gliding motility protein U Gene: Bd1477     GI: 42522988     BI number: Bd1477     GOG: -------     Description: hypothetical protein Gene: Bd1476     GI: 42522987     BI number: Bd1476     GOG: -------     Description: conserved hypothetical protein Gene: Bd1475     GI: 42522986     BI number: Bd1475     GOG: -------     Description: hypothetical protein Gene: Bd1474     GI: 42522985     BI number: Bd1474     GOG: -------     Description: conserved hypothetical protein Gene: Bd1473     GI: 42522984     BI number: Bd1473     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic ac c  c a  c        t at       t  a cg       a  a at       a  a t  t      c  a c  a      c  a t  t      a  t t  t      g  t at       a  a gc       t  a ta       c  a t  |      a  a a  |      a  a gc       t  a ta       a  c at        cg a  a       ta a  g      |  a a  |      c  t gt       t  t at        gc ta        ta tg        gt t  c       cg t  |       gc a  |      a  | t  |       ta a  |       tg a  |       gt        tc a  |       at       t  a a  |       ta        tg g  |      a  c       at a  |      c  c       at a  |       at        at cg        cg       g  t at        ta       t  g cg        ta        cg at        ta        cg gc        at        at                         tgttttaaacgaaactgaatccatcaagaagcatggtggggctcaggagggcataaccgtATG     ..................................................................................................................