                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.10 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=17 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:    Distance from promoter:56 nt.    Size=42 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcac-taattt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcacttcttcgattttattgttaatttagatccgttcaatgggccccgcaggcccatttttttttgtaccggccccgcccgggcagttcccacatgtc
gacccaaaacgtgcgacgaggtagctgagacaggttcttaggggcttgtttgagcttattttattttaggattgaacgaaATG

    Bd1545 --- nusA Gene: Bd1545     GI: 42523052     BI number: Bd1545     GOG: COG0779     Description: conserved hypothetical protein Gene: nusA     GI: 42523053     BI number: Bd1546     GOG: COG0195     Description: N utilization substance protein   a a  a c  a c  c cg at |  g                 ta gc                 t  g cg                  cg ta                  tg gc                  tg tg                  gc a  a                 gt c  |                 at a  |        g        cg cg       a  g       at cg       c  t       gt c  t       at        at ta        gc       g  g tg        at        ta gc        gt        cg at        ta        gc cg        cg        at                         tattttattttaggattgaacgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-12.30 kcal/mol Antiterminator: Size=77 nt.     Delta G=-13.50 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G=-11.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAAAACTCGGGTTTACGGAAGTTCGCCGGCGCCCCCGGTACTATAAGGACGGGGCCAC AGCGATTTTGTACTCACTATCCTGAcccacaaagggtccaagggctcagctcagataaacccttgcacttcttcgattttat tgttaatttagatccgttcaatgggccccgcaggcccatttttttttgtaccggccccgcccgggcagttcccacatgtcgacccaaaacgtgcgacgag gtagctgagacaggttcttaggggcttgtttgagcttattttattttaggattgaacgaaATG     Bd1545 --- nusA Gene: Bd1545     GI: 42523052     BI number: Bd1545     GOG: COG0779     Description: conserved hypothetical protein Gene: nusA     GI: 42523053     BI number: Bd1546     GOG: COG0195     Description: N utilization substance protein             t           c  t           t  c           t  g           c  a           a  t           c  t           g  t           t  t           t  a           c  t           c  t            cg   a        at c  a       at a  a      a  a cg        ta cg        at cg        gt At        at Gc       c  | |  c       ta |  a       cg Ta       g  a Cg       a  t Cg       c  c Tg       t  c A  c       cg T  t       gt C  c       gt         g A  |       gc       c  c C  |      |  a      c  a Ta       a  a       cg Cg        at        cg A  c       cg        gc T  t       cg        gc Gc        tg        gc Ta        gc        ta Tg        gc        at Ta        gc        at                         tttttttgtaccggccccgcccgggcagttcccacatgtcgacccaaaacgtgcgacgaggtagctgagacaggttcttaggggcttgtttgagcttattttattttaggattgaacgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here     ..................................................................................................................