Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.20 kcal/mol

                                                                        Nomenclature/Definitions

ACGGCCGTGTGGCTGTTTACGTTCCAGTTTCTGACGCCGCGGACCTGTGTGATTCCGA
CAAAGTGGGTATCCACATCCAAGTTACTGGCCGTGTGAAGTAAttttactgccaatttgaccgatttc
tttcaaaaaacccccatcactaaactgatgggggtttttatttctaagcccccctcacaaagaccctctcttattttctcaatacgcttacatccactct
gagaacttgccccctctagcgccccatattaaaaccaaccaacgctaaatgactcttattcgcaggaacatatcGTG

    Bd1578 --- Bd1577 --- iucA --- iucB --- iucC --- Bd1573 --- Bd1572


Gene: Bd1578     GI: 42523083     BI number: Bd1578     GOG: COG3182     Description: membrane protein
Gene: Bd1577     GI: 42523082     BI number: Bd1577     GOG: -------     Description: multidrug resistance protein
Gene: iucA     GI: 42523081     BI number: Bd1576     GOG: COG4264     Description: Aerobactin siderophore biosynthesis protein iucA
Gene: iucB     GI: 42523080     BI number: Bd1575     GOG: -------     Description: Aerobactin siderophore biosynthesis protein iucB
Gene: iucC     GI: 42523079     BI number: Bd1574     GOG: COG4264     Description: putative siderophore biosynthesis protein IucC
Gene: Bd1573     GI: 42523078     BI number: Bd1573     GOG: COG3486     Description: L-lysine 6-monooxygenase
Gene: Bd1572     GI: 42523077     BI number: Bd1572     GOG: COG1629     Description: TonB-dependent recepto


          aa
         t  a
         c  c
          at
          cg
          ta
          at
          cg
          cg
          cg
          cg
          cg
          at
          at
          at
            ttatttctaagcccccctcacaaagaccctctcttattttctcaatacgcttacatccactctgagaacttgccccctctagcgccccatattaaaaccaaccaacgctaaatgactcttattcgcaggaacatatcGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG3182 Uncharacterized iron-regulated membrane protein ... can be seen here
[Q] COG4264 Siderophore synthetase component ... can be seen here
[Q] COG4264 Siderophore synthetase component ... can be seen here
[Q] COG3486 Lysine/ornithine N-monooxygenase ... can be seen here
[P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here

    ..................................................................................................................