Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-18.95 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-22.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCAACAAGGTCAAAAACGCTACACGACTGAAATCGTGGCTTCCACAGTTCAGTTCC
TGGGTGCAGCTGGTGGCGAAAAGTCCTCTGGCAACTCTATGGGTAACGACGATTTCAA
CTTCCAAGATTTCGGTCCGGAGCCTAGCTTCAACTCTAACGATGAAATTCCATTCTAA
cggcggcagccggcagagctggagcgtcggagacgcgtaagctgaagcagcattaaattaagcctaaagccctgaagtaattcggggctttttttttgcc
ttttaagttcttataattaaagggctATG

    Bd1581 --- Bd1580


Gene: Bd1581     GI: 42523086     BI number: Bd1581     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critica
Gene: Bd1580     GI: 42523085     BI number: Bd1580     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


            g
          g  a
           cg
           ta
           gc
           cg
           gc
          a  g
          g  t
          g  a
           ta
           cg
           gc
           at
 gc       |  g
g  a      |  a
 cg       |  a
 gc       |  g
 gc       |  c
 cg       |  a
A  g      |  g
A  c      |  c
 Ta       |  a
 Cg       |  t
 Ta       |  t
 Tg       |  a
|  c      |  a
 At       |  a
 Cg       |  t
 Cg       |  t
 Ta       g  a
T  g      a  a
A  |       cg
A  |       gc        ta
A  |       gc       g  a
 Gc       c  t       at
 Tg       c  a       at
 At       g  a       gc
 Gc       a  a       tg
 Cg        cg        cg
A  |       gc        cg
A  |       gc        cg
T  |      c  |       gc
 Cg        gc        at
 Ta        gt        at
 Cg        cg        at
                        ttttttgccttttaagttcttataattaaagggctATG


    ..................................................................................................................