                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAAAAGTTTGAAGACCTCATCTTTTTCGGTGGCCAGCAGGCTGCCGATGTTGAAAAG
CTCGTTTTGCACCTTTTCCAGGGAATGATTGAGTTCTGACATCTCGGGGAAGGGGGCC
AAAGTCGAACGCACCACACCCAGATAGCTGTTCAGTTCGTCCACGGTTCCGTAGGCCT
CGACGCGTGGATTGAATTTTTCAACACAGGAGCCGTCCACAAGGCGGGTGCTGCCTTT
GTCGCCAGTGCGCGTATAAATTTTGGCTTTGGGAGCATTCGTCATAGATTTGACCCTT
CTTGTATTTAGTG

    Bd1603 --- Bd1604 --- Bd1606 Gene: Bd1603     GI: 42523108     BI number: Bd1603     GOG: COG3741     Description: putative formiminoglutamase Gene: Bd1604     GI: 42523109     BI number: Bd1604     GOG: -------     Description: putative cytochrome c biogenesis protein Gene: Bd1606     GI: 42523110     BI number: Bd1606     GOG: COG0755     Description: probable cytochrome C-type biogenesis protei   T G  C A  G A  A A  A C  C CG GC G  A GC GC G  A                  G A  C                A  G A  A                T  C G  |                G  C GC                 C  T GC        TT       C  C GC       G  C       TG C  |       TA        TA TA        CG        GC CG        GT       |  G TA        AT        GC AT       |  C       CG C  |       TG        AT A  |       AT        CG G  |       GC        CG T  |      |  C       TA C  |      A  A      |  T TA       C  C       GT TG        CG        CG GC        CG        TA AT        AT        TA                         TTTTTCAACACAGGAGCCGTCCACAAGGCGGGTGCTGCCTTTGTCGCCAGTGCGCGTATAAATTTTGGCTTTGGGAGCATTCGTCATAGATTTGACCCTTCTTGTATTTAGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3741 N-formylglutamate amidohydrolase ... can be seen here [O] COG0755 ABC-type transport system involved in cytochrome c biogenesis, permease component ... can be seen here     ..................................................................................................................