                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -8.55 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGATGGAAGGTAAGAACATGTTCCTGATGCTGGGTCCAGACCCGCTCAAGATCAAAG
AATACCAGAAACTTCACCCGAACAAGTCCAAGCAAGACACCAAAGAACTTGCTGAGCT
TGAAGAGGTCGAAGAAGACGACGAAGAGTAAaaggtacctctgccgtaccctccgcaggagggcccccggcagtttt
tccgaagcgctgcgtcgaaccagtaagctgatacaatttgttcaataaaacccacgttgaagaatgtgggttttgtttttttagaatctgatttatcagg
agcccctATG

    Bd1619 Gene: Bd1619     GI: 42523123     BI number: Bd1619     GOG: COG1490     Description: D-tyrosyl-tRNA(Tyr) deacylas   g c  a ta gc c  | gc ta cg gt |  a |  a cg gc at a  g g  a c  t c  a t  c t  a t  a t  t t  |       aa gt       g  g at        ta cg        ta gt        gt gt        cg |  c       at |  a       cg |  a       cg c  t       cg c  a       at c  a       at c  a       at c  a       at gc        tg gc        at gc        at             tttttagaatctgatttatcaggagcccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1490 D-Tyr-tRNAtyr deacylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.70 kcal/mol Antiterminator: Size=70 nt.     Delta G= -8.55 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G= -6.43 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAGATGGAAGGTAAGAACATGTTCCTGATGCTGGGTCCAGACCCGCTCAAGATCAAAG AATACCAGAAACTTCACCCGAACAAGTCCAAGCAAGACACCAAAGAACTTGCTGAGCT TGAAGAGGTCGAAGAAGACGACGAAGAGTAAaaggtacctctgccgtaccctccgcaggagggcccccggcagtttt tccgaagcgctgcgtcgaaccagtaagctgatacaatttgttcaataaaacccacgttgaagaatgtgggttttgtttttttagaatctgatttatcagg agcccctATG     Bd1619 Gene: Bd1619     GI: 42523123     BI number: Bd1619     GOG: COG1490     Description: D-tyrosyl-tRNA(Tyr) deacylas             t           a  a            aa            ca           t  |            ta            gc            tc            tc           |  a           |  c   g        tg c  a       at ta        at gc       c  g c  |      a  a gc       t  a ta       a  g cg       g gt       t |  a      c |  a      g cg       a  | gc        a at        t a  g       g g  a       a c  t       c c  a      | t  c      |         aa t  a      |        g  g t  a      c         ta t  t      a         ta t  |      a         gt gt       g         cg at       c         at cg        t        cg gt        g        cg gt        c        cg                         ttttgtttttttagaatctgatttatcaggagcccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1490 D-Tyr-tRNAtyr deacylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-19.00 kcal/mol Antiterminator: Size=34 nt.     Delta G= -6.80 kcal/mol Anti-antiterminator:   Size=46 nt.     Delta G= -6.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAGATGGAAGGTAAGAACATGTTCCTGATGCTGGGTCCAGACCCGCTCAAGATCAAAG AATACCAGAAACTTCACCCGAACAAGTCCAAGCAAGACACCAAAGAACTTGCTGAGCT TGAAGAGGTCGAAGAAGACGACGAAGAGTAAaaggtacctctgccgtaccctccgcaggagggcccccggcagtttt tccgaagcgctgcgtcgaaccagtaagctgatacaatttgttcaataaaacccacgttgaagaatgtgggttttgtttttttagaatctgatttatcagg agcccctATG     Bd1619 Gene: Bd1619     GI: 42523123     BI number: Bd1619     GOG: COG1490     Description: D-tyrosyl-tRNA(Tyr) deacylas AG A  A G  A CG TA GC G  G       ct         c A  A      c  c      g  a G  C       at        cg A  G       tg        cg A  A       gc        ta G  A       gc        cg TG       a  g       cg TA       a  |       cg CG       A  |      |  c GT        At       |  c |  A       Ta       a  c |  A       Gc       t  c A  a      A  c       gc G  a       Gc        cg Tg        At        cg Cg       A  c       gc Gt        Gc        ta Ta        Cg        cg                         tttttccgaagcgctgcgtcgaaccagtaagctgatacaatttgttcaataaaacccacgttgaagaatgtgggttttgtttttttagaatctgatttatcaggagcccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1490 D-Tyr-tRNAtyr deacylase ... can be seen here     ..................................................................................................................