Gene putatively regulated by attenuation in B_bacteriovorus
Characteristics of the secondary structures
Terminator: Distance to gene:57 nt. Distance to run of Ts=2 nt. Size=30 nt. Delta G=-21.90 kcal/mol
Antiterminator: Size=50 nt. Delta G= -6.05 kcal/mol
Anti-antiterminator: Size=39 nt. Delta G= -4.20 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TCCGATCAACTACACTCGCACAGTTTCTGACTGCAAATACATCGGTAAAAACCGTGAA
GTTTGCACAGACAAAGTTGTCTCTGGCACTTACCCACTGACTGTGAACGTGAAAGTTT
CCAAAAAAATGAGCTCTCGCAATGACACTTACAAATTCTTATTCAACAAGGCTTTGAC
TGTCCCTTCCTGCCACTAGtctgcatttttaacccggggctcctcaacgagcctcgggtttcatttttgaaacttgccaaacgccg
acgcccccaatacgtcatctggaaacaagcgaggtcgtgcATG
Bd1644 --- Bd1643
Gene: Bd1644 GI: 42523146 BI number: Bd1644 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critica
Gene: Bd1643 GI: 42523145 BI number: Bd1643 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critic
c
t t
G g
A c
T a
C C t
T A A t
T A C t
A C C t
TA G t
TA T a
CG C a ca
T G C c t a
T C T c c c
AT T c cg
AT Cg ta
AT Cg cg
CG Cg gc
A A Tg gc
T C Gc gt
T | | t gc
C | T c cg
AT C c cg
CG At cg
AT Gc at
GC Ta at
tcatttttgaaacttgccaaacgccgacgcccccaatacgtcatctggaaacaagcgaggtcgtgcATG
..................................................................................................................