Gene putatively regulated by attenuation in B_bacteriovorus
Characteristics of the secondary structures
Terminator: Distance to gene:152 nt. Distance to run of Ts=0 nt. Size=20 nt. Delta G= -6.40 kcal/mol
Antiterminator: Size=37 nt. Delta G= -9.70 kcal/mol
Anti-antiterminator: Size=51 nt. Delta G=-12.44 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ATAAAGTCTCCTTTTGGTTTGTTTGATGGACCCTGATTCCACCAGATTCCGCGGCGAT
TCAAtcagaattgcggggcggattgaagattcccggacaagtttctttgtgtccggcgcaaggtttggacaagagatggtttgtccttgtttggtat
attttttccatcatgtcagaggacatactaaagcagagggccgtctgatttttatcacttccgccgacaaatcaggggttgagctacgcgggtgtctgat
gactttgttatcctagaagggaacttttgaaccaaggaggctagcATG
Bd1646 --- Bd1647
Gene: Bd1646 GI: 42523148 BI number: Bd1646 GOG: ------- Description: hypothetical protein predicted by Glimmer/Critica
Gene: Bd1647 GI: 42523149 BI number: Bd1647 GOG: ------- Description: putative ferredoxi
ga
g c
c a
c a
c g
t t
t t a
at c a
gc g g
at cg
at gt
gt | t
tg gt
| t cg
tg cg
at ta
gc gc
gc ta at
cg g | g g
g g t | a g
g | t | gt
g | ta at
gc cg at
cg ta cg
gc tg at
ta ta gc
ta gt gc
ttgtttggtatattttttccatcatgtcagaggacatactaaagcagagggccgtctgatttttatcacttccgccgacaaatcaggggttgagctacgcgggtgtctgatgactttgttatcctagaagggaacttttgaaccaaggaggctagcATG
..................................................................................................................