                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:162 nt.     Distance to run of Ts=1 nt.   Size=16 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCATCCCAGGCTTTAGCTGACCTGAGCGCTCGGCGTCCTCGATCATCGCCAGACCGA
TGCGGTCTTTGACGGATCCCAGGGGATTAAAGAACTCAAGCTTTAGCAGAAGACGCCC
CGGCAAACCTTTGCCGATTCTTTGCATTTCGATTAAGGGGGTTTGACCAATGGTTTTC
GTGATATCAGAATATATTCTCATaagatgccgatctccgtatcttccatgatactcccgttgcgggaccggacaaagatgaag
tttatggttttttgttttcatttcgttaataaggggaaatcctATG

    Bd1709 Gene: Bd1709     GI: 42523205     BI number: Bd1709     GOG: COG1661     Description: putative DNA-binding protei   T A  G GC        TC CG       C  A CG       A  A AT       A  G GC        GC AT        AT C  T       AT C  |       AT GT        TA CG        TG TA       |  C |  C      |  A A  G      |  G CG       |  A TA       |  A AT       |  G GC       |  A |  C      |  C |  C      A  G       CC |  A       GC       A  T CG        GC        AT TG        GC        AT CG        GC        CG CG       A  |       GC TA        CG        GC GT        CG        CG                         ATTCTTTGCATTTCGATTAAGGGGGTTTGACCAATGGTTTTCGTGATATCAGAATATATTCTCATaagatgccgatctccgtatcttccatgatactcccgttgcgggaccggacaaagatgaagtttatggttttttgttttcatttcgttaataaggggaaatcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1661 Predicted DNA-binding protein with PD1-like DNA-binding motif ... can be seen here     ..................................................................................................................