                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions

TGATCGCTCAATTGATCGCTACTATCGGCGGCTAAggcgcggcagcgcaggaggccgtagggccgctactccgg
cactgccggagtgtaagcggtcgcgaaggctggacttcggctctgccgaggaggcgtagctggactccggctctgccgaggaggcgtagctggactttct
tcctggttacaattcaaaccccacaagctaacacttgtggggttttcttttttttgtccacaggacctcgggccattctgacaccaaacttgtgacaagt
ctgtttggcaggtcgtataaacaagtATG

    Bd1716 Gene: Bd1716     GI: 42523212     BI number: Bd1716     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic           aa          t  c          c  a           gc           at           at           cg           at           cg           cg           cg           cg           at           at           at             tcttttttttgtccacaggacctcgggccattctgacaccaaacttgtgacaagtctgtttggcaggtcgtataaacaagtATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.60 kcal/mol                                                                         Nomenclature/Definitions TGATCGCTCAATTGATCGCTACTATCGGCGGCTAAggcgcggcagcgcaggaggccgtagggccgctactccgg cactgccggagtgtaagcggtcgcgaaggctggacttcggctctgccgaggaggcgtagctggactccggctctgccgaggaggcgtagctggactttct tcctggttacaattcaaaccccacaagctaacacttgtggggttttcttttttttgtccacaggacctcgggccattctgacaccaaacttgtgacaagt ctgtttggcaggtcgtataaacaagtATG     Bd1716 Gene: Bd1716     GI: 42523212     BI number: Bd1716     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic           aa          t  c          c  a           gc           at           at           cg           at           cg           cg           cg           cg           at           at             ttcttttttttgtccacaggacctcgggccattctgacaccaaacttgtgacaagtctgtttggcaggtcgtataaacaagtATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:126 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-17.20 kcal/mol Antiterminator: Size=47 nt.     Delta G=-22.40 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G=-20.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGATCGCTCAATTGATCGCTACTATCGGCGGCTAAggcgcggcagcgcaggaggccgtagggccgctactccgg cactgccggagtgtaagcggtcgcgaaggctggacttcggctctgccgaggaggcgtagctggactccggctctgccgaggaggcgtagctggactttct tcctggttacaattcaaaccccacaagctaacacttgtggggttttcttttttttgtccacaggacctcgggccattctgacaccaaacttgtgacaagt ctgtttggcaggtcgtataaacaagtATG     Bd1716 Gene: Bd1716     GI: 42523212     BI number: Bd1716     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic   g c  a        t g  a      g  a cg        cg tg        gc gc        gt gt       |  g cg       a  g g  g      g  a a  |       gc a  |       at t  |      |  c        g g  |       gc       a  g ta        cg       g  a gc        cg        cg at        gc        cg gt       t  t       gc gc       c  c       tg cg       t  t      c  t cg        cg        ta gc        gc        cg t  t       gc        gc c  c       cg        gt at        ta        cg cg        tg        cg gc        cg        ta                         ctttcttcctggttacaattcaaaccccacaagctaacacttgtggggttttcttttttttgtccacaggacctcgggccattctgacaccaaacttgtgacaagtctgtttggcaggtcgtataaacaagtATG     ..................................................................................................................