                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=72 nt.     Delta G= -9.01 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATATCATCGCCCGAAAGTATGAGGAAGCCGGTTTGATTCGAAGTCTGAAGGTGCGCG
GGCTGGATTTGGTTGAATCCAAAATTTACCTGTCAGTTCGTTCTGACAAGATCAGCCA
GCGACTTTTTAAACAGTGGCAAACACAGTTAAAAGGTCTGCTGAAAACATAGaaatgtcat
ttgacatgatttgcacaatagagatgccccaacaaagggtgctttatattttaatgacatcatcacggagttactttagttactcactttggccccgggg
taataatttgaggagttattctaGTG

    Bd1723 --- Bd1724 --- pys --- Bd1726 Gene: Bd1723     GI: 42523219     BI number: Bd1723     GOG: -------     Description: putative octaprenyl-diphosphate synthase Gene: Bd1724     GI: 42523220     BI number: Bd1724     GOG: COG1233     Description: Phytoene dehydrogenase Gene: pys     GI: 42523221     BI number: Bd1725     GOG: COG1562     Description: phytoene synthase Gene: Bd1726     GI: 42523222     BI number: Bd1726     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic            tt           a  t            cg            ta            gc            ta            at           a  g           a  a           G  t           A  t           T  t           A  g           C  c           A  a           A  c           A  a           A  a            Gt            Ta            Cg           G  |            Ta            Cg            Ta           G  |   A       G  | C  A      A  | G  A      A  | GC       A  |        c TA       A  |      a  a GC       T  |      a  a A  A      T  |      c  a C  G      G  |       cg A  |      A  |       cg AT       C  |       cg AT       A  |       gt TA       C  |       tg TA       A  |      a  | TA       A  |       gc TA        At        at TG        Cg        gt CG        Gc        at AT        Gc        ta                         tattttaatgacatcatcacggagttactttagttactcactttggccccggggtaataatttgaggagttattctaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG1233 Phytoene dehydrogenase and related proteins ... can be seen here [I] COG1562 Phytoene/squalene synthetase ... can be seen here     ..................................................................................................................