Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.50 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -3.50 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGATCGGGGGAACAATCAGTTCGACGTTGCTGACACTATATGTGATTCCTGCTGTT
CACCTGTATGTGGATCGGTTCCAGAACTGGTTCATGGCAAAGTACCGCAAGGTCTTCG
GCCACGACGAAACAGTGATCTAAatatagaagccgtcccaaggggcggctttttttatgcccaaattcactcggcctctgcac
caaggtgaagggttgtaaatgtaagctggcactatagatggattctttcttgagcgactcttttcagtaatagaatagaacaaacgaaccaggaggttct
tATG

    Bd1752


Gene: Bd1752     GI: 42523245     BI number: Bd1752     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


 CA
G  A
 CG
 CG
 AT
T  |
 GC
 AT
 AT        at
|  C      A  a
A  G       At
 CG        Ta
 GC        Cg
 GC        Ta
 TA       A  a
|  C      G  |       aa
|  G       Tg       c  g
|  A       Gc        cg
A  C      A  |       cg
 CG       C  |       tg
 TA       A  |       gc
 TA       A  |       cg
G  A      A  |       cg
 GC        Gc        gc
 TA        Cg        at
 CG        At        at
 AT        Gc        gt
                        ttttatgcccaaattcactcggcctctgcaccaaggtgaagggttgtaaatgtaagctggcactatagatggattctttcttgagcgactcttttcagtaatagaatagaacaaacgaaccaggaggttcttATG
    ..................................................................................................................