                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:97 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:52 nt. Size=46 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:    Distance from promoter:45 nt.    Size=28 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tctcat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgactaaaaatattcactgtgtctcatcactaaagccatgaaatgactgcataatctcattggagtcgagtcgctagagctttttttgaagggctgtgg
tattctagttatatcaaatacaggagatttctcctgttcgctttttaagtcttttttgtcgactggttcaaaaaaagatctctcggagattcatccgaga
cacggggtaaacacaatttaatacgatagaaagggtcgagatgcgacagggtgtcttATG

    Bd1753 Gene: Bd1753     GI: 42523246     BI number: Bd1753     GOG: COG2076     Description: putative multidrug efflux transporte            ta           g  t           g  t           t  c            gt            ta            cg            gt            gt           |  a           g  t tt       a  a t  g       at ta        gc ta        ta tg        ta tg        ta        tt cg       |  t      a  t gc       |  a       gc at       |  c       at g  g       ta        gc at        tg        gc tg        tg        at cg        ta        cg gt        cg        at                         tcgctttttaagtcttttttgtcgactggttcaaaaaaagatctctcggagattcatccgagacacggggtaaacacaatttaatacgatagaaagggtcgagatgcgacagggtgtcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:91 nt.    Distance to gene:109 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G=-10.20 kcal/mol Antiterminator:    Distance from promoter:52 nt. Size=46 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:    Distance from promoter:13 nt.    Size=28 nt.     Delta G=-10.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgact-tctcat. It has a score value of 62.25 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgactaaaaatattcactgtgtctcatcactaaagccatgaaatgactgcataatctcattggagtcgagtcgctagagctttttttgaagggctgtgg tattctagttatatcaaatacaggagatttctcctgttcgctttttaagtcttttttgtcgactggttcaaaaaaagatctctcggagattcatccgaga cacggggtaaacacaatttaatacgatagaaagggtcgagatgcgacagggtgtcttATG     Bd1753 Gene: Bd1753     GI: 42523246     BI number: Bd1753     GOG: COG2076     Description: putative multidrug efflux transporte            ta           g  t           g  t           t  c            gt            ta            cg            gt            gt           |  a           g  t at       a  a a  c       at tt        gc ac        ta ca        ta gt        ta        tt tt       |  t      a  t cg       |  a       gc ag       |  c       at g  a       ta        gc tg        tg        gc at        tg        at ac        ta        cg ag        cg        at                         tcgctttttaagtcttttttgtcgactggttcaaaaaaagatctctcggagattcatccgagacacggggtaaacacaatttaatacgatagaaagggtcgagatgcgacagggtgtcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2076 Membrane transporters of cations and cationic drugs ... can be seen here     ..................................................................................................................