                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.91 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -5.61 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -3.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGGAAAAAAGCTGGCCTAAAACGGCGGTCACCGAATGCACCTTCACCATTGAAGAC
ACTGGAAAGGAACGTGTTCTGACGCTGGAACACAGCGGCTGGGACACCCTGCCGGCAG
AAATCCGCGCCAAAACCATCAAGGACTTCAAAGTCGGCTGGGGTTATCACCTGAAAGA
GCTTAAATCGTATCTGGATGATTGAagaaatttttgaaacgttttccaaacaaaatcctaactggcaaatgaccgcaaggaa
ttttataaaagccccgaaaccaagtcagtaacaaggggctttttATG

    Bd1783 Gene: Bd1783     GI: 42523271     BI number: Bd1783     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic at a  c a  c a  t       ca c  a      g  a a  a       cg a  c       cg at       a  a        t cg       g  |      g  c cg        ta       a  a t  c       at       a  g ta        at       c  t ta        at       c  a ta       |  t      a  a gt       |  a      a  c cg       |  t      a  a |  a      |  a      g  a a  c      |  a       cg a  c      |  a       cg a  g      |  a       cg gc        cg        cg ta        gc        gc ta        gc        at                         ttttATG     ..................................................................................................................