Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-12.60 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGGAATCAAAAGAGGCCATGACGAATTCGTACTTTTGCTGGAATTCGGCCTTGATG
GACGGGACTTCTTCTTCAACCTTGGTGCAAGCAGTTAGAGCCAGAGCCGCGATCAGCA
GCAGGTGTTGTATCTTCATGTTGTTCCCCCTGTACAAAACTATAGGCAAaggatgggacgtgga
gcaaccgtttatgttgccggacttggcgcactgccagcgtcatttttcgatgttggcagtgtctttcacttgttttctgggaaaactcgggcttaagatt
ttgctgaggaagcagcttccATG

    Bd1791


Gene: Bd1791     GI: 42523279     BI number: Bd1791     GOG: -------     Description: hypothetical protein predicted by Glimmer/Critic


 AA
A  A
C  C
 AT
 TA        ac
 GT       a  c
 TA        cg
 CG        gt
 CG        at
|  C      g  |
|  A       gt
|  A       ta
C  a       gt
 Cg        cg
 Cg        at
 Ta        gt
|  t      |  g        a
T  g       gc       c  c
G  g       gc       g  t
 Tg        tg        cg
 Ta       a  g       gc
 Gc       g  a       gc
 Tg        gc        ta
 At        at        tg
 Cg        At       |  c
 Tg       A  g       cg
 Ta        Cg        at
 Cg        Gc        gc
                        atttttcgatgttggcagtgtctttcacttgttttctgggaaaactcgggcttaagattttgctgaggaagcagcttccATG
    ..................................................................................................................