                                                                        Gene putatively regulated by attenuation in B_bacteriovorus

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-28.33 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTGGCTGTGGTGGGGCGAAGGCTGAAAAGTCCGCTTGTTCCGGCACTGAGTGTGCT
ACGAAAAAAGGTGGATGCGCTGATTGTGCGAAGAAGGAAGAGGCTGCTGCAGCAAAAT
AGtgcagcccgggttgcgcttgtcagtcttttcaaaaccccgcagtctgcggggttttttcgtttggagcagatggatttacgcacccccgtcgggatg
agttcaaatcattaaatgttttgatttggatagtctgctaaattactttttccttcgaaagtgcatttcggaaggaaattgaaaaATG

    Bd1797 --- nolG_lrep_1 Gene: Bd1797     GI: 42523285     BI number: Bd1797     GOG: -------     Description: - Gene: nolG_lrep_1     GI: 42523286     BI number: Bd1751     GOG: COG0841     Description: NolG efflux transporte            cg           c  g            cg            gt            at            cg            gc            tg            Gc            At           T  |           A  |           A  |           A  |           A  |           C  |           G  |            At            Cg            Gt           T  |           C  |            Gc            Ta            Cg            Gt            Gc            At            Gt   A        At A  A       At C  A       Gc G  T      |  a A  A      G  a        t CG       A  a      g  c Gt       A  a      a  t T  |      G  c       cg Cg       A  c       gc Gc       A  c       cg Ta        Gc        cg Cg        Cg        cg Gc        Gc        cg Gc        Ta        at                         tttttcgtttggagcagatggatttacgcacccccgtcgggatgagttcaaatcattaaatgttttgatttggatagtctgctaaattactttttccttcgaaagtgcatttcggaaggaaattgaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG0841 Cation/multidrug efflux pump ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bacteriovorus                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-12.80 kcal/mol Antiterminator: Size=26 nt.     Delta G= -9.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGTGGCTGTGGTGGGGCGAAGGCTGAAAAGTCCGCTTGTTCCGGCACTGAGTGTGCT ACGAAAAAAGGTGGATGCGCTGATTGTGCGAAGAAGGAAGAGGCTGCTGCAGCAAAAT AGtgcagcccgggttgcgcttgtcagtcttttcaaaaccccgcagtctgcggggttttttcgtttggagcagatggatttacgcacccccgtcgggatg agttcaaatcattaaatgttttgatttggatagtctgctaaattactttttccttcgaaagtgcatttcggaaggaaattgaaaaATG     Bd1797 --- nolG_lrep_1 Gene: Bd1797     GI: 42523285     BI number: Bd1797     GOG: -------     Description: - Gene: nolG_lrep_1     GI: 42523286     BI number: Bd1751     GOG: COG0841     Description: NolG efflux transporte            cg           c  g            cg            gt            at            cg            gc            tg   A        Gc A  A       At C  A      T  | G  T      A  | A  A      A  | CG       A  | Gt        At T  |       Cg Cg        Gt Gc       A  | Ta       C  | Cg        Gc Gc        Ta Gc        Cg             tcttttcaaaaccccgcagtctgcggggttttttcgtttggagcagatggatttacgcacccccgtcgggatgagttcaaatcattaaatgttttgatttggatagtctgctaaattactttttccttcgaaagtgcatttcggaaggaaattgaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG0841 Cation/multidrug efflux pump ... can be seen here     ..................................................................................................................