                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGAGCGTTGGATGGACTCGAGTGAGGCCTCCATCTGCTGTTGGGCCGCACGCCACTG
TTCGGCTACCGCGGTGAACTGGGTGGCCGCCGAACCTCGCCATGCGTCCTGCAAGGCA
TTGAGATTGGTGTACATGCCGCCCACGGCCTGCCTGATTTGCGAGATCGAAGTGGCCA
CTGCGGCCGAGGATGATTGGATTCGCTCGGAATCTACCTGATATTGGGGCATcgttgctcc
ttttctagagggttaatggtatgtatggcggccgattgccaataccggccgttaaggtggaggatATG

    BL0004 --- BL0005 Gene: BL0004     GI: 23464632     BI number: BL0004     GOG: -------     Description: hypothetical protein Gene: BL0005     GI: 23464633     BI number: BL0005     GOG: COG0745     Description: response regulator of two-component syste             C           A  C           T  T            CG            TA            AT           |  A            AT            GT           G  G   T        CG C  C       TG        cg G  G       CG       T  t CG        GC        At TA       C  |       Cg TA       T  |       Gc AT        TA        Gt GC        AT        Gc GT        Gc        Gc                         ttttctagagggttaatggtatgtatggcggccgattgccaataccggccgttaaggtggaggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here     ..................................................................................................................