Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-25.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGTTGAACACGATGCACTCCATGGCGGCGATGGCGGCGACGGCGGCCAGCAAGGCGA
TCAGCAGGCGCACCAAACGCAGCCGGTGCCGGGTATCCGGGCGGCTGGGCAGGTGCCG
TTCATGATTCGACGGCATCGGACGGTCTGCGCGAGTGTGGTCTATGGAATGCACgcattt
attctataggctttattcgggcttgatgtcgggcaaacaagagacaatgtgaatcatgccaaaacgtacatcggaccatgggaagcacaaccgcacgcca
ctgctgggcgggctgaaggattcgATG

    BL0051


Gene: BL0051     GI: 23464679     BI number: BL0051     GOG: -------     Description: hypothetical protei


 GA
T  T
A  T
C  C
 TG
 TA
 GC        GA
 CG       C  G
 CG        GT
 GC        CG
 TA        GT
 GT        TG
 GC        CG        gc
A  G      T  T      C  a
C  G       GC       A  t
G  A       GT       C  t
G  |      C  A       Gt
 GC       A  T       Ta
 TG       G  G       At
 CG       G  G       At
|  T      C  A       Gc
 GC        TA        Gt
 GT        AT        Ta
 CG        CG        At
 GC        GC        Ta
G  G      |  A       Cg
 GC        GC        Tg
 CG        Cg        Gc
                        tttattcgggcttgatgtcgggcaaacaagagacaatgtgaatcatgccaaaacgtacatcggaccatgggaagcacaaccgcacgccactgctgggcgggctgaaggattcgATG
    ..................................................................................................................