                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTCTTGATGCCGTACGGTGCGTTGGCCGAATCACCAAAATACAGCACATGCTCGGC
CGGCATATCCTTGGCGATTTGGCGAGCCACGGAAATACCGCCAAGACCCGAATCGAAT
ACGCCGATTGGAGCCGAAGAGCTCATgcctgaatcctccctatagccatgcctgcaaccgtatgttgccgcgaccgatcac
aaagccgattgttttgtggtgttgtttcgctccctagagtactctgaaagccatgagtcttccgcaacgagtaaccaagacacacgcaaccggcaatgat
ttcGTG

    dapF Gene: dapF     GI: 23464713     BI number: BL0087     GOG: COG0253     Description: diaminopimelate epimeras            aa           a  g           c  c           a  c            cg   t        ta g  a       at c  t       gt cg        cg at       |  t at       c  t cg        at gc        gt t  c       cg c  |       gt cg        cg gc        cg tg        gt             gttgtttcgctccctagagtactctgaaagccatgagtcttccgcaacgagtaaccaagacacacgcaaccggcaatgatttcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0253 Diaminopimelate epimerase ... can be seen here     ..................................................................................................................