                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=25 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTTGGCGCCAAGCGCGATGGCGCCACATGGTTCCTGGCCCCCGCGTCGAATTGTTT
GGATGTGGCAGGCCGCGTGCCGGATGGTCTGCGCGACGTCAAGGTCGCCACGCTGAAC
GAGGCGTATCAGGCGTTGGTGGCCATCGGCAAGGGGCAGGCCGACGATTTGCCTCATT
GCGAGGCATGAcacgcgcggccagtcgttgtttctggtgagacgactcgcatgggtctgcccacaatgcggcgattttcggccgcgttaacg
catttgttcgcgaagacttgctaatgtgtcccctGTG

    BL0095 Gene: BL0095     GI: 23464721     BI number: BL0095     GOG: NOG06580     Description: narrowly conserved hypothetical protei gg t  t cg ta tg ta gc tg ta gc c  | t  |                 tt g  |                t  t a  |                a  c c  |                g  g c  |                 cg gt        ct        gc gc       t  g       gc cg        gc        cg gc        gc        gc c  a       gc        tg gt        ta        at cg       |  c       at a  g      |  a      c  a cg       |  a      a  a At        at       c  c Gc        cg       c  | T  |       gc        cg At        cg        gc Cg        tg        ta                         tttgttcgcgaagacttgctaatgtgtcccctGTG     ..................................................................................................................