                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCCGGCCAAGATCAAGGACGGTTCTTTCGTGCTCGGCACCAACGACTTCAAGGGCG
CTCAGGAATACTTCGACTTCCTGGCTGAAGAAGACGCATACACCGACAGTCATGACAA
GATAATTCATGAGGCCCCGCAGGCCAAGGACCTTGCCACCGACGAATTCATCGGCAAG
TAAtttccgatattccgagtttgaatctacgcaaaaatgcgtccttcccatgaggaaaggacgcatttttgcgtatcgaccgataaggttattcatag
cggatcacgctaacaaggagacgattctATG

    BL0102 Gene: BL0102     GI: 23464728     BI number: BL0102     GOG: COG1957     Description: possible inosine-uridine preferring nucleoside hydrolas            tg aa       a  a a  a       cg at        cg cg       c  a gc        ta cg        ta at        cg t  c       cg c  c       ta t  |       gc at        cg at        gc gc        ta             tttttgcgtatcgaccgataaggttattcatagcggatcacgctaacaaggagacgattctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG1957 Inosine-uridine nucleoside N-ribohydrolase ... can be seen here     ..................................................................................................................