                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGCCTCCGAAGGCCCGCGCGCCATCAAGCTCGTCGCCGAGTCCGGTAGTCTCAAGG
TGGATTCCCTGAAGCTCCACCACATGAAGTCCATCGGACTGGAGTAGctctctcacctccctctg
acgagggaggtttttttgtgcgccctgtcgttcgccttcgcctatactgatggacggcatataacacgatccatcacacgaccggcaggcgcgcaggctc
ctcaccttactgttccacgccccggccgcaagcgccaccagcaaaccggactggcgcggaaagcaaggtgacatcccATG

    BL0104 Gene: BL0104     GI: 23464730     BI number: BL0104     GOG: COG0600     Description: possible permease protein of ABC transporter syste            ct           t  c           c  t           G  c           A  a           T  c            Gc        ga            At       t  c            Gc        cg            Gc        ta   T       T  c       cg A  C      C  |       cg CG        At        cg CG        Gc        ta TA        Gt        cg GC        Cg        cg AT        Ta        at                         ttttttgtgcgccctgtcgttcgccttcgcctatactgatggacggcatataacacgatccatcacacgaccggcaggcgcgcaggctcctcaccttactgttccacgccccggccgcaagcgccaccagcaaaccggactggcgcggaaagcaaggtgacatcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here     ..................................................................................................................