                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-15.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGACATCTCCGTGGTCGGCGTGGACAACCATCGCGTGTTCGCCGAAACGCTGGAACC
GATGCTCACCACTGTGGAACTGCCACATTTCGAGATGGGCTACTGGGCCGTGGCCAAG
CTGGTGTCGATTATCGAAGGACGCTCGATGGACGACGTCTCATGGCCAGCGACCACCG
CTCCCCTGCCGCCGATTGACGCGCCGATTCCGGCGAAGATCCACTGCACGCTGATCGA
AAAGACCTCGGTGAAGTAGccgagtcccacacgatttctcaaggcctccgtccagcacggaggcctttTTG

    cscB --- cscA Gene: cscB     GI: 23464732     BI number: BL0106     GOG: COG0477     Description: sucrose transport protein Gene: cscA     GI: 23464731     BI number: BL0105     GOG: COG1621     Description: beta-fructofuranosidase (sucrase/invertase); possible inulinas AG A  T G  A TG Gc Gc Cg Ta C  | Cg At Gc |  c A  c A  a A  c A  a Gc Cg Ta At Gt |  t |  c |  t |  c |  a |  a |  g |  g        a |  c      c  g |  c      c  c T  t       ta C  c       gc Gc        cg Cg        cg At        ta C  c       cg Gc        cg Ta        gc Cg        gc             tttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [G] COG1621 Beta-fructosidases (levanase/invertase) ... can be seen here     ..................................................................................................................