                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:186 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-22.80 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGGCGCGGAGACTGCGCAGAAGTCGGTTGGGTGAtcggtttcctcacagtggaataactgctgatgatgtc
cattcggcgtcttgcgtggtgatatgcagggcgccgttttgttgttctagtaattgtcggtaacggttgaggccggtgccggtggataggtctgcgtctc
cagcggacaatcagcgtctgtgatgtcacatgcaatgccaggagcggcatcaacggtcgaatcatgcggagtcactgcactgtgcgccgcttctcccctg
ccttcaatcacatcaatgacttgatgcGTG

    BL0110 Gene: BL0110     GI: 23464736     BI number: BL0110     GOG: -------     Description: hypothetical protei             g           t  t           a  c            gc            ta           |  t            at            gc            tg            cg            gc            tg        tg           c  t      g  a           a  c       gt   t       a  |       ta a  a      t  |       gt a  a       at        cg gc        at        gc gt       g  g       ta tg        gc        tg gc        tg        cg at       g  t       tg cg       a  g       gc |  a       cg        cg at        at        gc cg        cg        gc ta        ta        cg                         ttttgttgttctagtaattgtcggtaacggttgaggccggtgccggtggataggtctgcgtctccagcggacaatcagcgtctgtgatgtcacatgcaatgccaggagcggcatcaacggtcgaatcatgcggagtcactgcactgtgcgccgcttctcccctgccttcaatcacatcaatgacttgatgcGTG     ..................................................................................................................