                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:8 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCATGGCCCAGGAGCGCGTCGCTCTTGACAAGGTGGCCGATTACGTGGCCGCCCGCA
TCGGCGAGAAGCGCACCCGCGTGCCCCTGAAGCCTGTGGAAATGGGCGGTGAGCCTTG
GCCTGAGTCCGGCGTTCAGGAAGCCGGCGGCCTGTACTAAgccggagtcgcacaacttgggctcccctct
gtgggctgagccgtaaggaagacatcccagtgggctgtttgtaggcgaagtggcggcgatagacgccggggctcctctctcaggggagcccctacttatt
ttcttaggaatcacATG

    BL0117 Gene: BL0117     GI: 23464743     BI number: BL0117     GOG: COG0042     Description: possible NifR3-like protei   g a  t cg cg cg t  c at cg at gt at         a a  g      t  g g  t      a  a g  a       gc a  g       cg a  |       gc tg        gc         t gc        cg       c  c cg       g  g      t  a |  a      g  g       cg |  a       tg        tg cg        gc        cg gt        at        cg |  g      a  |       ta a  g      g  |       cg gc       c  |       gc tg        gc        gc cg        gc        gc gc        at        gc                         tacttattttcttaggaatcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0042 tRNA-dihydrouridine synthase ... can be seen here     ..................................................................................................................