                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-22.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -5.62 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gacttgatgagcttgtcgcccagagaatcagggtcgttgagccggtcctcgcgcagcctgttgaccttctcgtcgatgcggtgcaggctgtcgaccgcac
ggtcggcgctggaggggaagtcggtgttcgtttcgtcgctcatgactctcagtctaatagcatctcaatcatctcagcgcaaaagatgggcgttaatggt
ggagtcatgaacgagcgcagactagagtggaggcatgagcgaacagaacgtgaacggcaccgttgccgtcgagaactctcgtggcggcaacggatttttg
GTG

    BL0140 Gene: BL0140     GI: 23464760     BI number: BL0140     GOG: COG0406     Description: hypothetical protein in PgaM phosphoglycerate mutase famil gt a  g       ga g  g      t  a a  a       gc tg        cg cg       a  g a  c      a  c g  a      g  a at       a  c       ac cg       c  |      a  t g  a      a  |       gc cg       a  |       at gc        gc        gc |  g       cg        cg |  a       gt       |  t |  a      a  |      |  g a  c      g  |       tg g  a      t  |       gc c  g       at        cg a  a       cg        cg a  a       gc        gc gc        gc        ta tg       a  g       ta at       g  t       gc cg        gc        cg ta        tg        cg                         atttttgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0406 Fructose-2,6-bisphosphatase ... can be seen here     ..................................................................................................................