                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCGCTGCTGGTGCAGCTGTTCACCAACCCAGTGCTCGATCGCGTGGATCCAGTCAG
CTCGCTCAAGTCCGTGGAATGAccttgctgagccccctctgtgagggaggtgattcgcactaagttcaatttggtgttggcaaa
ttgaactttttggctgaatatttacagtatcattgcatgtgttcttgagctgagcggttttcgtgacatatttcggtgatacagtctgaacttgtcttga
acgagtatcgcgtccggtgcgtaacaatcgggcggcagagaagagaaatgaaattagtATG

    aapA Gene: aapA     GI: 23464772     BI number: BL0156     GOG: COG1113     Description: amino acid permeas   g t  t cg ta cg cg cg c  | c  | g  | a  | g  | t  | c  | g  | t  |                  t ta                 g  t cg                 t  g cg         c       g  g At       t  a       gc G  g       ta        ta Ta        gt        ta At        at        ta At        at        at Gc        tg        at |  g       cg        cg Gc        at        ta Ta        cg        ta Gc        gt        gc                         tttttggctgaatatttacagtatcattgcatgtgttcttgagctgagcggttttcgtgacatatttcggtgatacagtctgaacttgtcttgaacgagtatcgcgtccggtgcgtaacaatcgggcggcagagaagagaaatgaaattagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1113 Gamma-aminobutyrate permease and related permeases ... can be seen here     ..................................................................................................................