                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:205 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTAGAGCGCTTCGTTCGCATCGAAGAGGTCGCGGTTTCGACTACCGTCAGCTCCA
CGAgaccctctgcattcattccaccgtagagggtcttttcattttgttttcgttgaaattctgccatctcgcgtttcaaggggctgatttggggtttg
ccggaggtctacttgcgtttcgaggggctgatggtcaagtagatacgccgccaaaatggcggaatagcgttgcgtcaaagccgtttgtactggtgcttca
ccggatgaggagccccttgaaacggaagtagacctccggaacatGTG

    Ala Gene: BL0166     GI: 23464782     BI number: BL0166     GOG: COG0313     Description: conserved hypothetical protein with tetrapyrole methylase domai            AC           T  C            CG            AT            GC           C  A           T  G           T  C           T  T AG        GC        tt G  G       GC       a  c AT       C  A      c  c GC        GC       t  a TG        CG       t  c GC        TA       a  c tG       |  g       cg a  |      |  a       gt cG       |  c       ta aT        Gc        cg aT        Gc        ta gT        At        cg gC        Gc        cg cG        At        cg                         tcttttcattttgttttcgttgaaattctgccatctcgcgtttcaaggggctgatttggggtttgccggaggtctacttgcgtttcgaggggctgatggtcaagtagatacgccgccaaaatggcggaatagcgttgcgtcaaagccgtttgtactggtgcttcaccggatgaggagccccttgaaacggaagtagacctccggaacatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0313 Predicted methyltransferases ... can be seen here     ..................................................................................................................