                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGATGGTGGTGCTTGCTCATggtttctcagtgtaagctgtttctcagtgtaggctaccgtcagcaacgctcgtaaggcagtc
cggtaagatgttcgactacacgacgggtatcgccaatctcggccgcctgaacttgccgtctcttgccacgagcgcaacattcccggaaaagtaacgcaac
cggcaagcgagacggccgccatcctgccgccttttctgcctcatcagcccattttctgcctcattttgataaaatatgatgtagaaaagttcgtatgatg
cagaaaatgaggcagtATG

    BL0192 Gene: BL0192     GI: 23464807     BI number: BL0192     GOG: COG3177     Description: narrowly conserved hypothetical protei            cg           c  g           c  a           t  a           t  a        c           a  a      a  g            cg       g  g   c        at       a  c g  c      a  a       gc t  a      c  a       cg t  c       gc        gc cg        cg       |  c ta        gc       |  a cg       a  a      |  t t  |      g  a      |  c gc       c  c      a  c cg       a  c       at c  |       cg        cg gc        cg        gc ta        gc        gc ta        ta        cg                         ccttttctgcctcatcagcccattttctgcctcattttgataaaatatgatgtagaaaagttcgtatgatgcagaaaatgaggcagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3177 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................