                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-23.20 kcal/mol
Antiterminator: Size=52 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-16.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCTGGCGCACACCGGTGACCCGAAGCACTGCGTTATCGTGCTCACTGCGTCGCGCG
AAATCGCCGAAGCAGCCGACACACTCTTCGAAATCTGAtgttcagaccatagagccccctgtgattcgtatt
gccgaatcacaggggtttttcaatgccgcggctcattgccgcgctaatctgaggataaatctgaccgtacgaggcgaaacctgataatcatgaccggata
tattcccacactggagcagatcgacgagttgcaccgcaaaatcgcgccgtccaaggcggcgtacgagctgGTG

    BL0196 Gene: BL0196     GI: 23464811     BI number: BL0196     GOG: COG1418     Description: conserved hypothetical protei             g           t  t           A  t            Gc            Ta            Cg            Ta           A  c           A  c AA       A  a A  T      G  t GC       C  | CG       T  | GC        Ta C  |       Cg GC        Ta        tt CG        Cg       a  g TA       |  c      t  c G  A      |  c       gc CG       |  c       cg GC       |  c       ta TA       |  c       ta CG        At        at |  C       Cg        gc A  C       At        ta CG        Cg        gc TA       |  a       ta C  |      |  t       cg GC        At        cg TA        Gc        cg GC        Cg        cg                         tttttcaatgccgcggctcattgccgcgctaatctgaggataaatctgaccgtacgaggcgaaacctgataatcatgaccggatatattcccacactggagcagatcgacgagttgcaccgcaaaatcgcgccgtccaaggcggcgtacgagctgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1418 Predicted HD superfamily hydrolase ... can be seen here     ..................................................................................................................