                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.00 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=24 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:    Distance from promoter:70 nt.    Size=49 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-TTTTCT. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTTCAATCAGATGCTTTCATTTTCTGAGTCAATGAAACACCATATGAAAAAAAC
AATCAAAAAGTTAGTGGGATCTGAGAATGCGCGTCAAGCGGCTGCTTTACTGACTGGA
CGAAAATAGcgtaataaacagataataaacagaatgccggacggctgtttgggttgtttcggcattctttgttaagatgattaatgtttattta
gttaggaaataacgtttttagaaagaaaagtctgggATG

    BL0230 Gene: BL0230     GI: 23464837     BI number: BL0230     GOG: COG2244     Description: hypothetical transmembrane protein possibly involved in polysaccharide biosynthesi   A A  T A  A A  G Gc Cg At |  a |  a |  t                  t |  a                t  t |  a                g  g G  a                 tg Gc                  cg Ta        ga        gt Cg       g  c       gt A  a       cg        cg Gt        cg       |  t Ta        gc        at C  a      t  |       gt At       a  |       gc Ta       a  |       cg Ta       g  |       cg Ta        at        gc C  |       cg        ta Gc        at        at Ta        at        at Cg        at        gc                         tttgttaagatgattaatgtttatttagttaggaaataacgtttttagaaagaaaagtctgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2244 Membrane protein involved in the export of O-antigen and teichoic acid ... can be seen here     ..................................................................................................................