                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.03 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-11.84 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCCGATACCGCCGCCCGTCTGGCTGTCGACATCGTCAAGCGCCTGTAActggtcacctcca
agttcggcgttgccggtgtgggctggtacatggctatcatgactgccctcgctctgctcgctctgttcctgatcaaggaaagcaaggacaaggactacga
gctgtaaatagagctccccatattatgctcccgccagcgggagcattttgttatgtcgtcccgccaaaaatgaacaatagacgaacttacgtagtttagg
catctcactacgcctcgcacgttttactctggaaatcATG

    BL0317 Gene: BL0317     GI: 23464918     BI number: BL0317     GOG: COG0642     Description: histidine kinase sensor of two-component syste gg a  a a  a c  a t  g a  c g  a       aa ta       a  t cg       t  a cg       g  g ta        ta |  c       cg t  a       gc g  a       at tg        gc cg       |  c ta       c  c |  c      a  c |  t      t  a c  a      c  t       ca gc       a  a      c  g cg       g  t       gc ta       g  t       cg cg       a  a       cg gc        at        cg t  t       cg        ta c  |      |  c       cg t  |       at        gc cg        gc        ta gt        gc        at                         tttgttatgtcgtcccgccaaaaatgaacaatagacgaacttacgtagtttaggcatctcactacgcctcgcacgttttactctggaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................