                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-18.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGAATCGGTAAAGATCGCCAACGCGGCGGCATCCATCGCCATCCAGCACAGCCTCAA
CGGCGTGCCGCAATGCCCCGATTACGACGAGGCCATCGCGCTGATCGGCGAATAGtcga
ctataggtagctccccccagtccgcttcgcggccagctcccctcagcgaggggagctatttttgctctggctccccttagaaagaggcccggcattattc
atccgccgttcaaccggaatggctcccctaccctagtccgcgcttctacgatagattgagttgaatactgtcgaggagtgtatATG

    BL0332 Gene: BL0332     GI: 23464933     BI number: BL0332     GOG: COG2270     Description: narrowly conserved hypothetical protei             t           t  c            cg            gc            cg            cg gc       t  c a  t      g  c t  c      a  | gc       c  | gc       c  |        g a  c      c  |      a  c t  c      c  |       cg a  c      c  |       ta ta       c  |       cg cg        ta        cg at        cg        cg gc        gc        cg c  c       at        ta tg       t  c       cg Gc        gc        gc At        gc        at                         atttttgctctggctccccttagaaagaggcccggcattattcatccgccgttcaaccggaatggctcccctaccctagtccgcgcttctacgatagattgagttgaatactgtcgaggagtgtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2270 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................