                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:213 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTCACACCGAAGGGGTCGTAGGTTCGATTCCTACATCGCCCACCCgagattcacgctcgttgg
ccatgtggccgcgagcgttttttcataatcgatgtattccgattatgccggtccaatcggggtgcgggctagaatgccgcggagccggcagaatggcggg
attccgccgatgcaacctgtggttgcgcgcgaatatgcaacctgaagatggtggcgcggaactggtttgccgtggcatagtgagggcatcggccgaatat
gtcatgatgagcattacctatgaagggacactccgATG

    BL0333 Gene: BL0333     GI: 23464934     BI number: BL0333     GOG: COG1396     Description: hypothetical protein with helix turn helix moti   c t  a t  c a  g gc at        tg gc       a  t Cg        cg C  t       cg C  t       gc A  |       gc C  |      t  | Cg        tg Cg        gc Gc        cg C  c       ta Ta        cg At        gc Cg        cg At        at             tttttcataatcgatgtattccgattatgccggtccaatcggggtgcgggctagaatgccgcggagccggcagaatggcgggattccgccgatgcaacctgtggttgcgcgcgaatatgcaacctgaagatggtggcgcggaactggtttgccgtggcatagtgagggcatcggccgaatatgtcatgatgagcattacctatgaagggacactccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1396 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................