                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctaaacgcacgtgtcgtgttcccagggacgaaagcggcaccatcggccccatgcgtggggtggcacgtgcgttgaccttcgtcgcggccttgcgccgctg
accatatgcgacggccttggctccatgccgaaatgcttcacatgtgggaacccttcgggaagaacgggaatcaggaaccttcttgattcttgttttccca
aagggttccccgctctaaccttccaccatccgaaattcattgattccatcgattacaggacttacccacttaaccgcctacgagctgattggagaacatc
ATG

    BL0370 Gene: BL0370     GI: 23464968     BI number: BL0370     GOG: -------     Description: hypothetical protei   g g  a g  a cg ta        cc ta       a  t |  c       at cg        gc cg        gt cg        at a  a       cg a  a       ta g  |       at gt        at gc        gc ta        gt             tgttttcccaaagggttccccgctctaaccttccaccatccgaaattcattgattccatcgattacaggacttacccacttaaccgcctacgagctgattggagaacatcATG     ..................................................................................................................