                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTGCTGACGCCGCCGAAAAGGAAATCATTGCCGCGCGTCAGCGTCTCGCCGATTCC
GAGAAGTGAttcgattctgaatcgttgacaggaggccccttcgggggccttttgttgtatttgtggcaaagccgctctactctccctcagtcgc
agtttcactgcgccagctccccaacagagggagcttgtattttgtgatacagtaatgttttgtcttttcaactaggcgtaggcggcgtgtaggaacgctg
gtcgaggcccatcgcacggtaatccggcgatgaaccttctgtcacaccATG

    BL0390 Gene: BL0390     GI: 23464987     BI number: BL0390     GOG: COG1971     Description: integral membrane protein in the upf005   t         c t  c      a  a t  a      a  g gc       c  a at        cg cg        cg gc        cg cg        ta |  c       cg |  c       gc |  a       at tg       c  t gc        cg at        gt             attttgtgatacagtaatgttttgtcttttcaactaggcgtaggcggcgtgtaggaacgctggtcgaggcccatcgcacggtaatccggcgatgaaccttctgtcacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1971 Predicted membrane protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_longum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-17.40 kcal/mol                                                                         Nomenclature/Definitions TGGTGCTGACGCCGCCGAAAAGGAAATCATTGCCGCGCGTCAGCGTCTCGCCGATTCC GAGAAGTGAttcgattctgaatcgttgacaggaggccccttcgggggccttttgttgtatttgtggcaaagccgctctactctccctcagtcgc agtttcactgcgccagctccccaacagagggagcttgtattttgtgatacagtaatgttttgtcttttcaactaggcgtaggcggcgtgtaggaacgctg gtcgaggcccatcgcacggtaatccggcgatgaaccttctgtcacaccATG     BL0390 Gene: BL0390     GI: 23464987     BI number: BL0390     GOG: COG1971     Description: integral membrane protein in the upf005           tc          t  g           cg           cg           cg           cg           gc           gc           at             tttgttgtatttgtggcaaagccgctctactctccctcagtcgcagtttcactgcgccagctccccaacagagggagcttgtattttgtgatacagtaatgttttgtcttttcaactaggcgtaggcggcgtgtaggaacgctggtcgaggcccatcgcacggtaatccggcgatgaaccttctgtcacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1971 Predicted membrane protein ... can be seen here     ..................................................................................................................