                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGTGGGCGTGAGCCTGGCCTTCATGTTCACCAAAGCCCATATGGCATTCGCCATCC
TCAGCATCGGTGTGGTCACCGGACTGTTCTCCGCTGCGGGCCTGCACATTGGCCGCGC
GTTCGGTTCCCGCTGGCAGAAGCCGGCGCAGATCGCCGGCGGCGTGGTGCTGATTCTA
CTCGGCATCAAAGTGCTATTGGAGCATTTGGGCGTTATCGCGTTCTGAtttagtgtcataagcc
ccttcaccagaaagggctattttgtttgatttcaccgttccaatgcccgacgtaggattgggATG

    BL0391 Gene: BL0391     GI: 23464988     BI number: BL0391     GOG: -------     Description: hypothetical protei             G           T  A           C  t           T  t           T  t           G  a            Cg            Gt            Cg        cc           |  t      a  a           T  c       cg AT       A  a       ta T  C      T  t       ta TG       T  a      c  a GC       G  a       cg CG        Cg        cg GT        Gc        cg GT        Gc        gc GC        Gc        at                         attttgtttgatttcaccgttccaatgcccgacgtaggattgggATG     ..................................................................................................................