                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTGCTGTAATACTGGCCATCGGCCTCCAAAGCCATGGCGTGCGGAACGGTCAGGAT
GCCACCGGCCAGCAATGTGGCGGCAGCAACCACgcccgcgatggagcccttaaggccctgctgcatatggtgtgtg
ttcatgcagcattttctatcagccgcaagcaaacaagacacacgatggcaaggttacgagtctgaacttttgctatgcgttgtatgaacaatgcgcgacg
ccccgccgtaagatgacggaatgccgcgcattgtcaatacaggctgtatcagacgattgcctgtcaGTG

    BL0400a Gene: BL0400a     GI: 23464998     BI number: BL0400a     GOG: -------     Description: narrowly conserved hypothetical protei   t t  a c  a cg cg gc a  c gc gt         g t  g      t  t a  c      g  g gt       t  t cg        gt gc        gc |  a       ta |  t      a  | |  a      t  | c  t       at cg        cg cg        gc gt        ta Cg        cg At        gc Cg        ta             ttttctatcagccgcaagcaaacaagacacacgatggcaaggttacgagtctgaacttttgctatgcgttgtatgaacaatgcgcgacgccccgccgtaagatgacggaatgccgcgcattgtcaatacaggctgtatcagacgattgcctgtcaGTG     ..................................................................................................................