                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:109 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -8.50 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=26 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:77 nt.    Size=25 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACT-CAGCAT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACTCCGTGCTGTACACTCGCAGCATGGAAATGAAGAACGGCTTCCACATGTCCGA
CTTTTAGtccgtattgagctcccctccctgaggggagctgaccgcgaagcggactgagggggctaagccgttaagaaaacagcccagtgggctgt
ttttaggcgaagaggcggcggcagccgccccaccaccccgccccaccatcatcaacacagaaaggctttatATG

    fhs Gene: fhs     GI: 23465070     BI number: BL0478     GOG: COG2759     Description: formate--tetrahydrofolate ligas             g           a  a           a  a gg        ta g  g       ta gc        gc at       c  | g  a      c  | ta       g  |        g cg       a  |      a  t a  |      a  |       cg gc        ta        cg gc        cg        cg cg        gc        gc gt        gc        at at        gc        cg                         tttttaggcgaagaggcggcggcagccgccccaccaccccgccccaccatcatcaacacagaaaggctttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG2759 Formyltetrahydrofolate synthetase ... can be seen here     ..................................................................................................................