                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccggaattcttacaattgggcacgcttcttgatattgcatgaatattgcctgaatgcgctggttggtctgccgtgcgacccggcgcgcacgtttcgtgtc
gctgcgctggtccatacgtctccatagacttatccccagcctccacgcggcgctatgtcacccaactcccccagggcaggaatgcagcaagggtaagtgg
cctctgacgggtgtgtggaggttttctttatgtgcggatttggctgtgagctggcactagcgtggtcccctgtccggggcgcggccgtacagtcgaacgt
ATG

    BL0486 Gene: BL0486     GI: 23465076     BI number: BL0486     GOG: -------     Description: possible pre-pilin peptidas             a           c  a           g  g           a  g cc        cg t  c       gt c  c       ta a  c      a  a a  a      a  g cg       g  t cg       g  g cg       a  |       gt |  c       cg       g  g |  a       gc        gt a  g       gc        cg cg       |  t       at ta        gc       g  | |  a       at        tg g  t       cg        cg t  g      |  a       ta a  c      c  c       cg ta        cg        cg cg        cg        gt gc        cg        gt                         ttctttatgtgcggatttggctgtgagctggcactagcgtggtcccctgtccggggcgcggccgtacagtcgaacgtATG     ..................................................................................................................