                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.50 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCAAGAAGAAGCCGGCCAAGGTGACCGATGCTCAGTTGGACGTCATGGAAGACGGCA
TCAAGAACCTCGATAAGTAAgcaaggaatgtagattaccgcataaggaatcgtcgtgaaaatgaaggccctgactgtgcatatga
ggtcagggccttttctgcatgagatgggcgtgaaacaacagcgtggttatccacatttgtcgtggacgacatgccggggtgtggataactcagcaagcta
gaaccacaatggtcgattcgtgttgagcattgaactcggacacgtttcaatcggcttATG

    BL0509 --- BL0508 --- BL0507 --- BL0506 Gene: BL0509     GI: 23465099     BI number: BL0509     GOG: NOG07379     Description: hypothetical protein Gene: BL0508     GI: 23465098     BI number: BL0508     GOG: COG4962     Description: hypothetical protein possibly involved in adherence Gene: BL0507     GI: 23465097     BI number: BL0507     GOG: -------     Description: hypothetical protein Gene: BL0506     GI: 23465096     BI number: BL0506     GOG: -------     Description: hypothetical membrane protein with unknown functio            aa           g  a            ta            gt            cg            ta           g  a at       c  g       at c  a      t  g      c  a g  a      a  c      g  t cg       a  |      t  g cg        gc       g  a a  |       gc        tg ta        at        cg ta       |  g       at at       |  a       gc gc       |  c       ta a  g       at        cg t  t       tg        cg gc        at        cg tg        cg        gc at        gc        gc                         ttttctgcatgagatgggcgtgaaacaacagcgtggttatccacatttgtcgtggacgacatgccggggtgtggataactcagcaagctagaaccacaatggtcgattcgtgttgagcattgaactcggacacgtttcaatcggcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG4962 Flp pilus assembly protein, ATPase CpaF ... can be seen here     ..................................................................................................................