                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGTCCATGGTCCTGTGGGGTTGGTGAgtctggccgcattgcttcgattccttctccattcgtaaaactgtttgttat
ctcacatcgggcagctgccgaaaagcacgaatcttcttgacggagatgtcaaggtttgttacggtgacgtgcgaaaaccgattcgtaaggggtgctttag
gctgagacggtatgtgccgaacccttcgaacctgtgagctaacactcgcgtagggaatgcgacggttgaactcctctgttcggctcggcatcccatatgc
gcgttgagagagaggaagcgtATG

    BL0515 --- BL0514 --- BL0513 Gene: BL0515     GI: 23465105     BI number: BL0515     GOG: COG2233     Description: hypothetical transmembrane protein in xanthine/uracil permeases family Gene: BL0514     GI: 23465104     BI number: BL0514     GOG: NOG47133     Description: possible acyl protein synthase/acyl-CoA reductase-like protein Gene: BL0513     GI: 23465103     BI number: BL0513     GOG: NOG15417     Description: possible acyl-CoA reductas            aa           g  a           c  a            cg   t        gc c  c       ta t  a      |  c a  c      |  g t  a      |  a t  t      |  a gc       c  t tg        gc tg        at tg       c  t gc        gc ta        gt cg        gt        ag a  c       cg       g  a a  t       ta        gt a  g      a  c       cg a  c      c  g       at t  |      a  |       gc gc        cg        ta cg        ta        ta ta        cg        cg ta        ta        tg                         tttgttacggtgacgtgcgaaaaccgattcgtaaggggtgctttaggctgagacggtatgtgccgaacccttcgaacctgtgagctaacactcgcgtagggaatgcgacggttgaactcctctgttcggctcggcatcccatatgcgcgttgagagagaggaagcgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG2233 Xanthine/uracil permeases ... can be seen here     ..................................................................................................................