                                                                        Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=2 nt.   Size=38 nt.     Delta G=-16.59 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatcgacactgttgaggtgacgcatgctggtgcaaccgcgcccgccgctaacaccatgaatccgcctacgattcccctggcaccgatgaaacgtatgcag
gcgcggttcaatccgctcgccgacggactgatgtatgttgtggtgttcgtcggtggatttgttggagtcggctgtcggcatgcgttggatatgcttctgc
cgtcggtcagcgggacgccgttcgttgtgggcacgtttgtgtcgaatatggtcgcctgcttcctgttcgcgatgctgaccgaattcatggcgaccgcttc
GTG

    BL0547 Gene: BL0547     GI: 23465132     BI number: BL0547     GOG: COG0239     Description: hypothetical transmembrane protein with unknown functio ca g  c gc tg c  a c  t c  | cg ta ta a  a gc        ca        tg cg       t  a      a  t at       t  t      t  t |  a       gc       g  g |  t       gc       t  t |  g       cg       a  g |  c       gc       g  g ta       |  t      t  t cg       |  c       cg cg        cg        at gc        gc        gt cg        gc        gc |  c      a  g       cg cg       c  a       at tg        gc        gc at        tg        cg at       a  g       cg gc        ta        gt ta        gc        cg                         gatttgttggagtcggctgtcggcatgcgttggatatgcttctgccgtcggtcagcgggacgccgttcgttgtgggcacgtttgtgtcgaatatggtcgcctgcttcctgttcgcgatgctgaccgaattcatggcgaccgcttcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG0239 Integral membrane protein possibly involved in chromosome condensation ... can be seen here     ..................................................................................................................