Gene putatively regulated by attenuation in B_longum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.81 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-29.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGCCCGCACACCTTCCTGCCGTTGACGGGCATCACCCATATGACCAACGACGAGAC
CGTGGCCGAAAACCTGCTCACCCTCCAGCGCGATTTCCTGCGCGACGCGCTGGCCTGA
cagatcgataacacgcgcattccacccgaggtgctccaccggtaaagcgcctcgggtggtgcgccgcacccatttccgccctgaatttttggaaattttg
cactcatcgtcatgtgaaagaccggttttttgcctcatattcccatcaccgcgtaggatgggtgaagattagaaagggaggactATG

    BL0583 --- BL0584 --- BL0585 --- rodA --- pbpA --- pknA --- pknB


Gene: BL0583     GI: 23465168     BI number: BL0583     GOG: COG1716     Description: hypothetical protein with FHA domain
Gene: BL0584     GI: 23465169     BI number: BL0584     GOG: COG1716     Description: hypothetical protein with FHA domain
Gene: BL0585     GI: 23465170     BI number: BL0585     GOG: COG0631     Description: possible phosphoprotein phosphatase
Gene: rodA     GI: 23465171     BI number: BL0586     GOG: COG0772     Description: protein involved in cell wall formation and stabilization of the FtsZ ring during cell division
Gene: pbpA     GI: 23465172     BI number: BL0587     GOG: COG0768     Description: probable penicillin binding protein transpeptidase
Gene: pknA     GI: 23465173     BI number: BL0588     GOG: COG0515     Description: probable serine-threonine protein kinase
Gene: pknB     GI: 23465174     BI number: BL0589     GOG: COG0515,COG2815     Description: probable serine/threonine-protein kinase Pkn


  c
a  c
 cg
 cg
|  t
|  a        c
|  a      g  c
 ta        cg
 cg        gc
 gc        ta
 tg        gc
 gc        gc
 gc       |  c
 at       |  a
 gc       |  t
 cg       |  t
 cg       |  t
 cg       |  c
 at       |  c
 cg        tg
 cg        gc
t  |       gc
t  |       gc
 at       |  t
 cg        cg
 gc        ta
            atttttggaaattttgcactcatcgtcatgtgaaagaccggttttttgcctcatattcccatcaccgcgtaggatgggtgaagattagaaagggaggactATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG1716 FOG: FHA domain ... can be seen here
[T] COG1716 FOG: FHA domain ... can be seen here
[T] COG0631 Serine/threonine protein phosphatase ... can be seen here
[D] COG0772 Bacterial cell division membrane protein ... can be seen here
[M] COG0768 Cell division protein FtsI/penicillin-binding protein 2 ... can be seen here
[RTKL] COG0515 Serine/threonine protein kinase ... can be seen here
[RTKL] COG0515 Serine/threonine protein kinase ... can be seen here
[S] COG2815 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................